Archive

Tag Archives: synbio

I registered last minute for the Mammalian Synthetic Biology Workshop and it was awesome. It was really neat to see all the research everyone’s doing.

I got to chat with Ron and Mariola, from iGEM 2011. Definitely a blast from the past.

Ron and Mariola

Ron said he still shows my animation occasionally. Haha, sweet.

Irving Weissman gave a really cool stem cell keynote.

Weissman

Alex said Irv is like the godfather of stem cell research. Very impressive!

I unexpectedly ran into Pete! I haven’t seen him in like maybe 6 years!

Pete

It was great catching up!

Alex also gave a talk! I really enjoyed the talk, not only because I’d never heard Alex give a talk before, but also he had a clear and fun delivery style.

Alex

He thanked his wife, Amy, in the credits slide which I thought was super cute.

I think it’s super cool when couples are involved in each others’ fields. Amy probably provides some extraordinary research feedback just like how Harry gives me a lot of feedback for my conference talks.

Anyhoo, mSBW3 was great event. I saw some old friends, learned some neat stuffs, and in general had a good time.

One wish: I wish the the slides from talks are posted online somewhere. A great feature software conferences is that a lot of talks are recorded and the talks’ slides are posted online. This way, the conference can benefit a greater community.

Introduction

The name of GATTACA, a film about a genetically perfect distopia, was based off of the four nucleotides in DNA. Many hypothesize the name was inspired from GATATC, the DNA recognition sequence of the restriction enzyme EcoRV. Since GATATC is quite a few base pairs different from GATTACA, I became curious to see if any restriction enzyme would use GATTACA as its recognition sequence.

Methods

A short search in NEB’s Enzyme Finder uncovered BsaBI.

BsaBI has the following recognition sequence:

G A T N N / N N A T C
C T A N N / N N T A G

It nicely envelops GATTACA with its non-specific bases:

G A T T A / C A A T C
C T A A T / G T T A G

For example, the following 60bp DNA strand, when digested by BsaBI, would yield a 24bp strand and a 36bp strand, viewable on hi-density gels.

5′- TCGTACTTCGGCTCTACCAGATTA/CAATGGCCATTGTAATCTGGTAGAGCCGAAGTACGA -3′

5′- TCGTACTTCGGCTCTACCAGATTA -3′

5′- CAATGGCCATTGTAATCTGGTAGAGCCGAAGTACGA -3′

Introduction

I had theorized in my previous post that it was possible to easily 3D print an enzyme structure given a Protein Data Bank (PBD) file. Now, a month and many iterations later, I was finally able to print restriction enzyme Fok1 [PDB ID:1fok], bound to a strand of DNA. I had not anticipated the problems of 3D-printing such a complex structure when I first started this expedition, I now have a very robust and simple way of printing these structures.

3D printed Fok1 in hand

Result

3D-printed Fok1

The printed model, Fok1 [PDB ID:1fok], is in Sculpteo’s white plastic, and is approximately 4.8cm x 4.0cm x 4.3cm. It has a slight coarse and grainy texture, but still retains tiny details like arrowheads on the model. One factor that surprised me is the model’s flexibility. Whereas my previous printed models were rigid, this printed protein strand has spring like behavior in certain areas and can withstand some serious stretching.

Method Summary

My goal was to optimize simplicity in the PDB-to-3D-model methodology. This means, I wanted minimal manual adjustment of vertices to the PDB render. On top of that, I wanted to print a ribbon style model, which was more challenging to print than a mesh based model, due to its thin components.

I started by rendering the Fok1 [PBD ID:1fok] in Chimera. Chimera conveniently can export the model in a STL format, perfect for 3D printing. Before exporting, I thickened the model to meet minimum thinness requirements. Finally, I uploaded the STL to Sculpteo to print.

Sculpteo Render

Fok1 model on Sculpteo

Method Details

  1. Import PBD file into Chimera, via either a fetching of the file from PDB or a custom PDB file.
  2. Select the chains containing DNA or substrate and hide the atom and bond models. The atom and bond models typically are too thin to be printed, without more finessing.

  1. Select the remaining ribbon model and adjust the ribbon model attributes in Tools>Depiction>Ribbon Style Editor. The ribbon model, as is, is too thin to be printed. All attributes need to be thickened. The following is the setting I used for my Fok1 model.

Ribbon Style Editor Settings

  1. Export the scene to an STL and then upload the model to Sculpteo for printing. Sculpteo offers a beautiful, almost-real-time printability check of the model, for fast design feedback turnaround times.

Caveats

The major problems I encountered was having structures too thin to be printed. I initially tried to print with Shapeways. However, the first ~10 iterations didn’t even pass their manual checking stage. Printing a wirely protein structure is definitely pushing the boundaries of 3D printing capabilities. I eventually decided to switch to Sculpteo because of their significantly faster turnaround times. Sculpteo was awesome and definitely delivered.