Archive

Tag Archives: Iron Chef SynBio

Lab tape usually comes in sharp neon colors but I’d wanted something more personal, subtle, and fun. So, I got some lovely washi tape from uguisu.

Pros:

  • They are a tad less sticky than regular lab tape, but still adhere well to everything from glassware to cardboard boxes.
  • VMR lab markers write very well on them, as do Sharpies.
  • They leave no residue when peeled off, just like regular lap tape.
  • They can survive in the -4C freezer as well as 37C warm shakers. Though, if they become a little bit harder to peel if left in the warm room (still won’t leave residue). I haven’t tested the tape in -80C freezers.
  • They have beautiful patterns.

Cons:

  • Washi tapes are a bit sheer. It’s harder to cover up text in the background.

Overall, I think it’s delightful to use washi tape in lab. It’s a small, neat combination of science and crafts. One look at the oxalis design, and you’ll know those plates are mine.

Advertisements

absee has underwent a lot of structural changes.

First, it only retrieves the information you want instead of returning all traces and called bases.
Second, it’s a class now, so you can hold onto multiple sequencing data.
Third, it now has quality scores.

%irb
>> require ‘absee’
=> true
>> my_variable = ABSee.new()
=> #<ABSee:0x000001008599d0>
>> my_variable.read("/Users/Jenny/Desktop/my_sequence.ab1")
=> nil
>> my_variable.get_calledSequence()

Class Methods

  • read(file_location)
    • returns nil
  • get_traceA()
    • returns an array with the trace data for adenine
  • get_traceG()
    • returns an array with the trace data for guanine
  • get_traceC()
    • returns an array with the trace data for cytosine
  • get_traceT()
    • returns an array with the trace data for thymine
  • get_calledSequence()
    • returns an array with the Basecalled sequence
  • get_qualityScores()
    • returns an array with the Basecalled quality scores
  • get_peakIndexes()
      returns an array with indexes of the called sequence in the trace

Introduction

The name of GATTACA, a film about a genetically perfect distopia, was based off of the four nucleotides in DNA. Many hypothesize the name was inspired from GATATC, the DNA recognition sequence of the restriction enzyme EcoRV. Since GATATC is quite a few base pairs different from GATTACA, I became curious to see if any restriction enzyme would use GATTACA as its recognition sequence.

Methods

A short search in NEB’s Enzyme Finder uncovered BsaBI.

BsaBI has the following recognition sequence:

G A T N N / N N A T C
C T A N N / N N T A G

It nicely envelops GATTACA with its non-specific bases:

G A T T A / C A A T C
C T A A T / G T T A G

For example, the following 60bp DNA strand, when digested by BsaBI, would yield a 24bp strand and a 36bp strand, viewable on hi-density gels.

5′- TCGTACTTCGGCTCTACCAGATTA/CAATGGCCATTGTAATCTGGTAGAGCCGAAGTACGA -3′

5′- TCGTACTTCGGCTCTACCAGATTA -3′

5′- CAATGGCCATTGTAATCTGGTAGAGCCGAAGTACGA -3′

[updated again as a Ruby class]

absee has an update!

The 0.1.0.0 version now encapsulates the methods in a Ruby Module, instead of being global functions.

Example usage:

% irb
>> require ‘absee’
=> true
>> Absee.readAB(“/Users/Jenny/Desktop/my_sequence.ab1″)

It still returns six arrays (the trace values for ACGT, called sequence, and peak indexes).

More information can be found on my previous post.

Thanks goes to Dan Cahoon for forking my absee on github.

Introduction

I had theorized in my previous post that it was possible to easily 3D print an enzyme structure given a Protein Data Bank (PBD) file. Now, a month and many iterations later, I was finally able to print restriction enzyme Fok1 [PDB ID:1fok], bound to a strand of DNA. I had not anticipated the problems of 3D-printing such a complex structure when I first started this expedition, I now have a very robust and simple way of printing these structures.

3D printed Fok1 in hand

Result

3D-printed Fok1

The printed model, Fok1 [PDB ID:1fok], is in Sculpteo’s white plastic, and is approximately 4.8cm x 4.0cm x 4.3cm. It has a slight coarse and grainy texture, but still retains tiny details like arrowheads on the model. One factor that surprised me is the model’s flexibility. Whereas my previous printed models were rigid, this printed protein strand has spring like behavior in certain areas and can withstand some serious stretching.

Method Summary

My goal was to optimize simplicity in the PDB-to-3D-model methodology. This means, I wanted minimal manual adjustment of vertices to the PDB render. On top of that, I wanted to print a ribbon style model, which was more challenging to print than a mesh based model, due to its thin components.

I started by rendering the Fok1 [PBD ID:1fok] in Chimera. Chimera conveniently can export the model in a STL format, perfect for 3D printing. Before exporting, I thickened the model to meet minimum thinness requirements. Finally, I uploaded the STL to Sculpteo to print.

Sculpteo Render

Fok1 model on Sculpteo

Method Details

  1. Import PBD file into Chimera, via either a fetching of the file from PDB or a custom PDB file.
  2. Select the chains containing DNA or substrate and hide the atom and bond models. The atom and bond models typically are too thin to be printed, without more finessing.

  1. Select the remaining ribbon model and adjust the ribbon model attributes in Tools>Depiction>Ribbon Style Editor. The ribbon model, as is, is too thin to be printed. All attributes need to be thickened. The following is the setting I used for my Fok1 model.

Ribbon Style Editor Settings

  1. Export the scene to an STL and then upload the model to Sculpteo for printing. Sculpteo offers a beautiful, almost-real-time printability check of the model, for fast design feedback turnaround times.

Caveats

The major problems I encountered was having structures too thin to be printed. I initially tried to print with Shapeways. However, the first ~10 iterations didn’t even pass their manual checking stage. Printing a wirely protein structure is definitely pushing the boundaries of 3D printing capabilities. I eventually decided to switch to Sculpteo because of their significantly faster turnaround times. Sculpteo was awesome and definitely delivered.

[updated: 3D-Printed Enzyme – Proof of Concept]

Introduction

While animating a short for the 2011 MIT iGem team, I came up with the idea to 3D print enzymes from the vast number of structure-characterized proteins in the RCSB Protein Data Bank (PDB). There are lots of slick software out there to render the PDB files into gorgeous 3D models. Exporting those models to be 3D-printing compatible is only a few clicks away.

ecoRV

EcoRV [PDB ID: 1RVA]

Methods

The simplest approach is to use USCF Chimera to render a protein from PDB. Chimera can export the protein into an STL file, which can be uploaded to Shapeways or other 3D printing vendors to print.

While Chimera renders ribbon diagrams very beautifully, it lacks more sophisticated mesh-based renderings and user customization. Molecular Maya can be a good alternative. It harnesses all the customization power of Maya, while easily importing PDB files. To go the Molecular Maya route, proteins can be exported into OBJ files to upload to Shapeways. Currently, Molecular Maya does not render ribbon diagrams or secondary structure.

ecoRV

ecoRV rendered with mMaya [PDB ID: 1RVA]

Gallery

DNA ligase

DNA ligase [PDB ID: 1DGS]

EcoRI

EcoRI [PDB ID: 1ERI]