GATTACA Enzyme – Thought Experiment

Introduction

The name of GATTACA, a film about a genetically perfect distopia, was based off of the four nucleotides in DNA. Many hypothesize the name was inspired from GATATC, the DNA recognition sequence of the restriction enzyme EcoRV. Since GATATC is quite a few base pairs different from GATTACA, I became curious to see if any restriction enzyme would use GATTACA as its recognition sequence.

Methods

A short search in NEB’s Enzyme Finder uncovered BsaBI.

BsaBI has the following recognition sequence:

G A T N N / N N A T C
C T A N N / N N T A G

It nicely envelops GATTACA with its non-specific bases:

G A T T A / C A A T C
C T A A T / G T T A G

For example, the following 60bp DNA strand, when digested by BsaBI, would yield a 24bp strand and a 36bp strand, viewable on hi-density gels.

5′- TCGTACTTCGGCTCTACCAGATTA/CAATGGCCATTGTAATCTGGTAGAGCCGAAGTACGA -3′

5′- TCGTACTTCGGCTCTACCAGATTA -3′

5′- CAATGGCCATTGTAATCTGGTAGAGCCGAAGTACGA -3′