Archive

Monthly Archives: November 2012

In our recent post-dinner late-night wanderings, my friends and I discovered Finale!
finale
While I’d heard of high praises for Finale since eons ago, it was my first time stepping into one. We sat down on posh little red couches, and I enjoyed a delicious tiramisu.

tiramisu

In fact, the treat was so delicious that my friends and I went for an encore the very next day!
creme brulee

Mhmmm mhmmm crème brûlée!

Finale! I think this is the beginning of a delicious friendship!

Advertisements

I love surprises in the mail. When I subscribed to Lost Crates, I enjoyed “forgetting” my quarterly subscriptions and finding a lovely box of stationery in my mailbox every few months. Well, I thought I had cancelled my Birchbox subscription in October, but evidently not.

Surprise!

Here’s an November Birchbox!

The joy of trying out new samples trumped any irk I might’ve felt for not cancelling. Here’s what I got:

Chuao Chocolatier Assorted ChocoPod
I thought my snack was going to be a potato chip smothered with chocolate. Nope! It was a delicious blend of chocolate and potato chip powder, into a crunchy treat (similar in texture to the innards of a KitKat bar).
Chuao Chip

Miracle Skin Transformer Vanish Instant Imperfection Corrector
The product has a silky texture. I don’t think I’m going to be using it much.
Skin Vanish Corrector

stila all over shimmer liquid luminizer try-me-set
Perhaps I was expecting face glitter, but I saw no difference with this on. Also, no one’s skin “shimmers” naturally. I’m not a fan of processed beauty.
Stila Shimmer Liquid

Atelier Cologne Rose Anonyme Petite Cologne Absolue
The Rose Anonyme perfume sample came with a stunning film noir photo-card. Unfortunately, the scent was not as stunning. My skin is not a fan of incense, oud, and patchouli. All I got was wafts of not-so-good dried, spiced herb smell. Despite not behaving well on its own, it layered quite nicely with Blood Bath by Delightful Rot.
Rose Anonyme
Oscar Blandi Pronto Texture & Volume Spray Travel Size
I now finally know how people get their hair to stay in awkward configurations! It’s all about the hair spray! I’ve never used hairspray before, and this one was a pretty good experience.
Oscar Hair Spray
As I said before, I’m not quite a part of Birchbox’s target demographic. Being surprised by this box was super fun, but I finally decided to cancel (for real this time). Thanks for the good time, Birchbox!

Introduction

The name of GATTACA, a film about a genetically perfect distopia, was based off of the four nucleotides in DNA. Many hypothesize the name was inspired from GATATC, the DNA recognition sequence of the restriction enzyme EcoRV. Since GATATC is quite a few base pairs different from GATTACA, I became curious to see if any restriction enzyme would use GATTACA as its recognition sequence.

Methods

A short search in NEB’s Enzyme Finder uncovered BsaBI.

BsaBI has the following recognition sequence:

G A T N N / N N A T C
C T A N N / N N T A G

It nicely envelops GATTACA with its non-specific bases:

G A T T A / C A A T C
C T A A T / G T T A G

For example, the following 60bp DNA strand, when digested by BsaBI, would yield a 24bp strand and a 36bp strand, viewable on hi-density gels.

5′- TCGTACTTCGGCTCTACCAGATTA/CAATGGCCATTGTAATCTGGTAGAGCCGAAGTACGA -3′

5′- TCGTACTTCGGCTCTACCAGATTA -3′

5′- CAATGGCCATTGTAATCTGGTAGAGCCGAAGTACGA -3′

I take back every single nice thing I said about Spirit. They are the absolute worst. I write this at the airport, livid.

Today, I got to the airport 20 minutes before my flight. I admit, it was a little late, but usually the wonderful customer service people help me out. Well, I got to Spirit, and of course, the kiosk machines wouldn’t let me check in. I scan the room for a customer service representative. There were exactly ZERO.

Instead, a sign on the customer service desk read “call (800) 772 – 7117”, and so I do.
After listening to 5 minutes of instruction manuals, I finally get to a customer service operator. Ok, relief, I thought, now he can check me in virtually.

Operator: Hello, this is Spirit Airlines, my name is Henry, how may I help you?
Me: Hello Henry, my name is [full name], and I’m at the Boston airport. I’m late for check-in and my flight is departing soon. I’m flying to [destination] at [time]
Henry: Alright, what is your name?
Me: [my name, with spelling]
Henry: Where are you flying to?
Me: [destination and flight time]
Henry: What day are you flying?
Me: today
Henry: Ok. Can you spell your name?
Me: ….

I spent the next 20 minutes repeating every character of my name and repeating my flight time. He seemed to immediately forget my answer to his question.

Henry: I’m sorry I can’t find you. Do you have any other names?
Me: It may be under [other name] but I’m highly sure it’s not.
Henry: Ok. It says you’re flight is in June of 2013.
Me: My flight is today.
Henry: Who are you flying with?
Me: Myself

Apparently, he found a lady with a similar name to mine flying from Austin to Orlando June 2013, with a man friend named Michael. Definitely not me, who was struggling to leave the Boston airport.

Me: Do you want my confirmation code?
Henry: That would be very helpful, thank you.
Me: [confirmation code]
Henry: You’ve only said four letters, the confirmation code has six.

I was dumbfounded. He couldn’t be this hard of hearing. I repeated my confirmation code a couple more times before he finally go it.

Henry: I see that your flight has departed. There is nothing I can do.

OF COURSE IT HAS DEPARTED! I’VE BEEN REPEATED MYSELF ON THE PHONE FOR TWENTY MINUTES TO GET YOU TO HELP ME.

Henry: I cannot reschedule your flight since it has departed. This is Spirit’s policy.
Me: So you just made me miss my flight.
Henry: It is Spirit’s policy to check in 2 hours before the flight. I’m sorry.

Henry: Your entire itinerary is forfeit when you miss then outgoing flight. This is Spirit’s policy. Your return flight is now void. Please book a new flight on the Spirit website.

ARE YOU SERIOUS? NOT ONLY WERE YOU COMPLETELY INCOMPETENT AT HELPING ME, YOU ARE ALSO CANCELLING MY RETURN FLIGHT?

Henry: Is there anything else I can help you with?
Me: Yes. So, suppose my flight has not departed and I was not on the plane. Would you have been able to reschedule my flight?
Henry: If it has not departed, yes.

MY MISSED FLIGHT IS NOW YOUR FAULT, BY YOUR OWN ADMISSION.

Me: How do I filed a complaint?

The only slightly useful service Henry provided was giving me an address to file a complaint to Spirit.

Expect a angry letter, Spirit, you garbage of an airline.

[updated again as a Ruby class]

absee has an update!

The 0.1.0.0 version now encapsulates the methods in a Ruby Module, instead of being global functions.

Example usage:

% irb
>> require ‘absee’
=> true
>> Absee.readAB(“/Users/Jenny/Desktop/my_sequence.ab1″)

It still returns six arrays (the trace values for ACGT, called sequence, and peak indexes).

More information can be found on my previous post.

Thanks goes to Dan Cahoon for forking my absee on github.

Spirit has just become my favorite airline!
Spirit
Today, while I was changing the departure day for my upcoming trip home for Thanksgiving, instead of charging me exorbitant fees, they actually gave me a $100 credit!

I was also impressed by how easy it was to change my itinerary online.

I love you Spirit!

Perhaps it was the end of Lost Crates, or my love of mail, but whatever it was, it instilled in me a horrible itch: a craving of a monthly subscription service.

I went for a Birchbox, over the vast number of other possibilities, drawn by their “lifestyle products.” They were partnering with goop, a chic lifestyle blog (with beautiful pictures of food that I aspire to make one day).
birchbox
What I got:

beautyblender | the original beautyblender
beautyblender
This hot pink, egg-shaped sponge is suppose to give you a flawless blending of your foundation.  I’ll probably use it pressing on paint in stenciling shirts, since I don’t wear makeup.

Karuna | Hydrating Treatment Mask
mask
I’ve never worn a mask before, so I gave it a whirl. It had the most magnetic light and healthy scent! I felt goofy with the mask on (I hid from my roomies to avoid their bouts of laughter). My skin felt super nice afterwards. It was awesome.

Sprout | Lip Balm Flights
Sprout
I haven’t tried it so I can’t really comment. In general, lip balms made my lips even flakier. My goto remedy is a little bit of Rosebud Salve overnight. We’ll have to see how this compares.

Supergoop | City Sunscreen Serum
supergoop
Mhmm mhmmm SPF. I always forget to get (and use) sunscreen, so a little packet is very welcome.

twistband | Hair Tie
twistband
I got a very lovely green hair tie, but, contrary to the description of it looking nice on one’s wrist, there’s no way to put it around mine when I don’t have my hair up, so it won’t get much love.

LUNA | LemonZest
Luna
Most people seemed to not like the presence of a LUNA bar in their Birchbox. I was actually super excited to try it. It wasn’t the best of snack bars (probably because the lemon was too strong), but still tasty.

Overall, I liked Birchbox. I love the idea of samples, got an interesting medley of products. However, not wearing makeup, I’m definitely not their primary audience, and probably won’t subscribe again.