Archive

Monthly Archives: November 2012

In our recent post-dinner late-night wanderings, my friends and I discovered Finale!
finale
While I’d heard of high praises for Finale since eons ago, it was my first time stepping into one. We sat down on posh little red couches, and I enjoyed a delicious tiramisu.

tiramisu

In fact, the treat was so delicious that my friends and I went for an encore the very next day!
creme brulee

Mhmmm mhmmm crème brûlée!

Finale! I think this is the beginning of a delicious friendship!

I love surprises in the mail. When I subscribed to Lost Crates, I enjoyed “forgetting” my quarterly subscriptions and finding a lovely box of stationery in my mailbox every few months. Well, I thought I had cancelled my Birchbox subscription in October, but evidently not.

Surprise!

Here’s an November Birchbox!

The joy of trying out new samples trumped any irk I might’ve felt for not cancelling. Here’s what I got:

Chuao Chocolatier Assorted ChocoPod
I thought my snack was going to be a potato chip smothered with chocolate. Nope! It was a delicious blend of chocolate and potato chip powder, into a crunchy treat (similar in texture to the innards of a KitKat bar).
Chuao Chip

Miracle Skin Transformer Vanish Instant Imperfection Corrector
The product has a silky texture. I don’t think I’m going to be using it much.
Skin Vanish Corrector

stila all over shimmer liquid luminizer try-me-set
Perhaps I was expecting face glitter, but I saw no difference with this on. Also, no one’s skin “shimmers” naturally. I’m not a fan of processed beauty.
Stila Shimmer Liquid

Atelier Cologne Rose Anonyme Petite Cologne Absolue
The Rose Anonyme perfume sample came with a stunning film noir photo-card. Unfortunately, the scent was not as stunning. My skin is not a fan of incense, oud, and patchouli. All I got was wafts of not-so-good dried, spiced herb smell. Despite not behaving well on its own, it layered quite nicely with Blood Bath by Delightful Rot.
Rose Anonyme

Oscar Blandi Pronto Texture & Volume Spray Travel Size
I now finally know how people get their hair to stay in awkward configurations! It’s all about the hair spray! I’ve never used hairspray before, and this one was a pretty good experience.
Oscar Hair Spray

As I said before, I’m not quite a part of Birchbox’s target demographic. Being surprised by this box was super fun, but I finally decided to cancel (for real this time). Thanks for the good time, Birchbox!

Introduction

The name of GATTACA, a film about a genetically perfect distopia, was based off of the four nucleotides in DNA. Many hypothesize the name was inspired from GATATC, the DNA recognition sequence of the restriction enzyme EcoRV. Since GATATC is quite a few base pairs different from GATTACA, I became curious to see if any restriction enzyme would use GATTACA as its recognition sequence.

Methods

A short search in NEB’s Enzyme Finder uncovered BsaBI.

BsaBI has the following recognition sequence:

G A T N N / N N A T C
C T A N N / N N T A G

It nicely envelops GATTACA with its non-specific bases:

G A T T A / C A A T C
C T A A T / G T T A G

For example, the following 60bp DNA strand, when digested by BsaBI, would yield a 24bp strand and a 36bp strand, viewable on hi-density gels.

5′- TCGTACTTCGGCTCTACCAGATTA/CAATGGCCATTGTAATCTGGTAGAGCCGAAGTACGA -3′

5′- TCGTACTTCGGCTCTACCAGATTA -3′

5′- CAATGGCCATTGTAATCTGGTAGAGCCGAAGTACGA -3′

[updated again as a Ruby class]

absee has an update!

The 0.1.0.0 version now encapsulates the methods in a Ruby Module, instead of being global functions.

Example usage:

% irb
>> require ‘absee’
=> true
>> Absee.readAB(“/Users/Jenny/Desktop/my_sequence.ab1″)

It still returns six arrays (the trace values for ACGT, called sequence, and peak indexes).

More information can be found on my previous post.

Thanks goes to Dan Cahoon for forking my absee on github.

Perhaps it was the end of Lost Crates, or my love of mail, but whatever it was, it instilled in me a horrible itch: a craving of a monthly subscription service.

I went for a Birchbox, over the vast number of other possibilities, drawn by their “lifestyle products.” They were partnering with goop, a chic lifestyle blog (with beautiful pictures of food that I aspire to make one day).
birchbox

What I got:

beautyblender | the original beautyblender
beautyblender
This hot pink, egg-shaped sponge is suppose to give you a flawless blending of your foundation.  I’ll probably use it pressing on paint in stenciling shirts, since I don’t wear makeup.

Karuna | Hydrating Treatment Mask
mask
I’ve never worn a mask before, so I gave it a whirl. It had the most magnetic light and healthy scent! I felt goofy with the mask on (I hid from my roomies to avoid their bouts of laughter). My skin felt super nice afterwards. It was awesome.

Sprout | Lip Balm Flights
Sprout
I haven’t tried it so I can’t really comment. In general, lip balms made my lips even flakier. My goto remedy is a little bit of Rosebud Salve overnight. We’ll have to see how this compares.

Supergoop | City Sunscreen Serum
supergoop
Mhmm mhmmm SPF. I always forget to get (and use) sunscreen, so a little packet is very welcome.

twistband | Hair Tie
twistband
I got a very lovely green hair tie, but, contrary to the description of it looking nice on one’s wrist, there’s no way to put it around mine when I don’t have my hair up, so it won’t get much love.

LUNA | LemonZest
Luna
Most people seemed to not like the presence of a LUNA bar in their Birchbox. I was actually super excited to try it. It wasn’t the best of snack bars (probably because the lemon was too strong), but still tasty.

Overall, I liked Birchbox. I love the idea of samples, got an interesting medley of products. However, not wearing makeup, I’m definitely not their primary audience, and probably won’t subscribe again.

There was a chill in the air, this past All Hallows’ Eve when my friends and I boarded the commuter rail to Salem. Yes, the witch-trail Salem, also the party town Salem for hoards of ghouls and gals that flooded the streets in festive attire.
Riding Hood
We inhaled the music and the scene.
lights
After a brisk walk, we stumbled onto a carnival, beckoned by the electric lights of the Ferris Wheel.
With a few magical tickets, we climbed into a mechanical menace. While my friends laughed heartily, I gripped the safety bar in-front of me for dear life. I didn’t know why I decided to ride that ride. Roller coasters terrified me. Momentarily bewitched by the ambiance, I lost reason, and suffered the next eternity screaming at every momentary acceleration. It was fun, but TERRIFYING.
DX
The rest of the night flew by super fast. We stopped by a quaint hotdog vendor and gawked at the vast variety of edible awesomeness. We greeted a man who wore a Sleep No More mask.  We saw awesome fireworks in the distance, awkward for Halloween, but nevertheless festive.

The ride home was filled with loud and people hilariously singing and making general ruckus. It was definitely a lot of fun. Definitely not as spooky as I’d imagined, but still awesome was this  Salem, our town of Halloween.

Unfortunately, Lost Crates is on a long indeterminate hiatus. They sent me their last Petite Stationery crate at the beginning of October. It was their best one yet.

paperback writer
This small, brown notebook is perfect for jotting down notes. It’s super handy, on par with French Shirt Notebook by Pocket Dept from April.

Paperback Notebook

Action Cahier by Action Method
The Action Cahier is an oddball. Its no-nonsense black cover conceals the colorful pages inside. On one side of the page is a matrix of dots; the other, beige and teal stripes. I’m not sure how to work the Action Cahier yet, but I’m sure it’ll help me become more productive.
Action Cahier

French Paper Notebook
Small with gorgeous patterned covers, these notebooks are the reason why I became interested in stationery. They’re so perfect for everything. I have to think hard to fill them with appropriately awesome things.
French Paper Notebook
Lost Crates provided such wonderful surprises over the past year. Through them I became acquainted with so many quaint companies. I am a little sad to see them go, and hope they will come back one day.